Give an example of old english language transcription and the translation in modern english?
1. Give an example of old english language transcription and the translation in modern english?
Example of Old English ✔️RunicGermanicOfer hron rade Modern English ✔️RunningGermanyOver the whale's roadTranslation : BerlariNegara JermanDi atas jalan ada laut
[tex]semoga \: membantu[/tex]
2. Urutan basa yang cocok pada nomor 1 adalah GTGCATCTGACTCCTGAGGAGAAG DNA 1 (transcription RNA 2 ... ... (translation) protein 3
GTG CAT CTG ACT CCT GAG GAG AAG
3. Which the right method of translation? A. adaptation, borrowing, and faithful B. full and free translation C. semantic translation and structural translation D. word by word translation, faithful translation, and functional translation E. free translation, adaptation and communicative translation F. no answer Jawab a/b/c/d/e/f
Jawaban:
In my opinion E. free translation, adaptation and comunicative translation
4. What is translation and how many kinds of translation
Jawaban:
more in my friend who have been there was the first of course you can you have you are a good for you are in this subreddit without being temporarilybannedfrom the best to do it will result from around and I have the first of my wife of it would you have the best to get to get to
Jawaban:
apa itu terjemahan dan berapa jenis terjemahan nya
5. what is literal and idiomatic translation
Jawaban:
apa itu terjemahan literal dan idiomatik
Translate nya kedalam bahasa Indonesia =
Apa itu Literal dan Idiomatik / Apa yang literal & idiomatik?
PENJELASANNYA :An Idiom is an expression that means something different than the literal meaning of the words would suggest. We use idioms to express ideas, so we have to learn their meanings, and when to use them. Literal means the exact meaning of something. The literal meaning of a word is the actual meaning of that word.
Terjemahannya =ungkapan yang berarti sesuatu yang berbeda dari arti harfiah dari kata-kata tersebut. Kita menggunakan idiom untuk mengekspresikan ide, jadi kita harus mempelajari artinya, dan kapan menggunakannya. Secara harfiah berarti arti yang tepat dari sesuatu. Arti harfiah dari sebuah kata adalah arti sebenarnya dari kata itu.
6. Tolong berikan contoh dari Over translation,Reduced translation,dan False translation.
contoh kasus atau cpntoh soal ny ?over translation : penerjemahan kata yang berlebihan
reduced translation : pengulangan kata terseut, tp dgn bahasa baru. pokoknya isinya sama.
false translation : penerjemahan kata yang salah
7. What is translation and how many kinds of translation
Jawaban:
Penjelasan:
Apa itu terjemahan dan berapa jenis terjemahannya
8. Materi countable and uncountable nouns doc .....
Jawaban:
materi nya ada di foto yaa
Penjelasan:
semoga membantu^^
jangan lupa dijadikan jawaban terbaik^^
9. past tense exercise worksheet and
1. I …………………… a strange dream last A. night.
B. have
C. had
2. The people …………………….. at the
A. bull thief.
B. yelled
C. have yelled
D. had yelled
3. The young man …………………. his own life to save the life of his friend.
A. was risking
B. risked
C. had risked
4. I myself …………………… this.
A. see
B. had seen
C. saw
5. He …………………. gently to the child.
A. spoke
B. had spoken
C. have spoken
6. The children …………………. their best.
A. tried
B. were trying
C. try
7. The two men ………………….. ready to
leave on their pilgrimage.
A. are
B. were
C. had been
8. He ………………… at the entrance hesitantly.
A. stand
B. stood
C. had stood
9. Their families ……………….. them to prepare for the journey.
A. were helping
B. helped
C. had helped
10. Kabir ………………… the value of devotion and humility.
A. teaching
B. taught
C. had caught
11. The children …………………. and ………………….
A. were singing, dancing
B. sang, danced
C. had sung, danced
12. She ………………………… a letter to her grandmother.
A. wrote
B. had written
C. have written
Jawaban
1. I had a strange dream last night.
2. The people yelled at the bull thief.
3. The young man risked his own life to save the life of his friend.
4. I myself saw this.
5. He spoke gently to the child.
6. The children tried their best.
7. The two men were ready to leave on their pilgrimage.
8. He stood at the entrance hesitantly.
9. Their families helped them to prepare for the journey.
10. Kabir taught the value of devotion and humility.
11. The children sang and danced.
12. She wrote a letter to her grandmother.
10. P.16. Worksheet yang telah diselesaikan dengan menggunakan program excel secara otomatis filenyaA. DocB. WK1C. JpgD. DbfE. XLS
Jawaban:
E. XLS / XLSX (format baru)
Penjelasan:
Sebenarnya untuk Excel dari versi 2013 sampai 2019 dan Office 365 sudah menggunakan format baru berjenis XLSX. XLS hanya digunakan Office 2010 kebawah, dan sifatnya legacy, yakni didukung Office jaman sekarang namun tidak disarankan.
Adapun format lain yang didukung resmi oleh Excel adalah XLSM (Excel dengan dukungan macro) dan XLSB.
Intinya yang ada XLS nya sob.
11. a.formal greeting and Responses b.informal greeting and Responses C.dialog greeting 1 and the translation d.dialog greeting 2 and the translation E.dialog greeting 3 and the translation
Jawaban:disuruh ngapain?
Penjelasan:tolong di bantu yang bisa
g
d
x
d
12. contoh kalimat dari 1. word for word translation 2. Literal Translation 3. Faithful Translation 4. Semantic Translation 5. Adaptation Translation 6. Free Translation 7. Idiomatic Translation 8. Communicative Translation
Jawaban:
1. Word for Word Translation
A word for word translation can be used in some languages and not others dependent on the sentence structure
2. Literal Translation
Literal translation, direct translation or word-for-word translation, is a translation of a text done by translating each word separately, without looking at how the words are used together in a phrase or sentence.
3.Faithful Translation
Faithful translation attempts to reproduce the precise contextual meaning of the original within the constraints of the TL grammatical structures. It 'transfers' cultural words and preserves the degree of grammatical and lexical 'abnormality' (deviation from SL norms) in the translation.
4. Semantic Translation
Semantic translation is the process of using semantic information to aid in the translation of data in one representation or data model to another representation or data model.
5. Adaptation Translation
Adaptation occurs when something specific to one language culture is expressed in a totally different way that is familiar or appropriate to another language culture. It is a shift in cultural environment.
6. Free Translation
Sometimes known as “Creative Translation”, free translation is a way of translation without paying attention to the details while delete or add content to original meaning on the basis of keeping the general meaning in order to be fluent and natural.
7. Idiomatic Translation
Idiomatic translation refers to achieving a target text that sounds natural in the target language, while idiomatic expressions are idioms or fixed expressions in a given language.
8. Communicative Translation
Communicative translation is a translation method that attempts to render the exact contextual meaning of the source language so that both content and language are readily acceptable and comprehensible to the readership.
13. english worksheet connectors and, or, but
no, really,sorry if wrongjawabnnya adalah no,really,sorry if wrong
14. Advantages and disadvantages of interdisciplinarity for translation studies
Jawaban:
Keuntungan dan kerugian interdisipliner untuk studi terjemahan
Penjelasan:
Maaf kalau salah yaaa
15. WORKSHEET PAST TENSE 1 (REGULAR AND IRREGULAR VERB)
Jawaban:
Rumus = Verb + Ing
1. Waiting
2. Inviting
3. don't live
4. Did, like
5. don't visit
6. Did, dance
7. is stop
8. did not water
9. did not study
10. raining
Semoga Membantu!
16. beni and friends play football.The correct translation is ....
Jawaban:
Beni dan teman-temannya bermain sepak bola
#jadikan yang terbaik ya
Jawaban:
Beni dan kawan-kawan bermain bola
17. Choose the correct transcription for 'grab'l'græb//'graedl'græddChoose the correct transcription for pluck/'plack//'plæck//'plak/
Jawaban:
1. I'graeb
2. plack
Penjelasan:
kalau salah mohon maaf^^
jika benar tolong jadikan yang terbaik^^
Jawaban:
'grab' = [ ɡræb ]
pluck = [ plʌk ]
Penjelasan:
18. ASKING AND GIVING OPINION WORK WORKSHEET
Jawaban:
ga bisa bahasa Inggris;(
Penjelasan:
:(
TranslationEng»Id:
"Lembar Kerja Yang Meminta dan Memberi Pendapat".
19. What is the difference between idiom translation and free translation?
Jawaban:
Arti pertanyaan tersebut dalam bahasa Indonesia, yaitu :
Apa perbedaan antara terjemahan idiom dengan terjemahan bebas ?
JAWAB.
Terjemahan Idiom adalah suatu terjemahan serangkaian kata yang artinya tidak bisa diartikan secara harafiah, namun mewakilkan ekspresi tertentu yang tersirat di dalamnya. Bagi kalian yang suka membaca novel atau bacaan dalam bahasa Inggris, mungkin istilah tersebut sudah terdengar familiar. Idiom sebenarnya tidak hanya dikenal dalam bahasa Inggris, nyaris semua bahasa, termasuk bahasa Indonesia.
Dalam bahasa Inggris, terdapat banyak jenis idiom yang sering digunakan di berbagai kondisi. Contoh yang bisa menjelaskan bagaimana idiom digunakan adalah seperti “last straw”, yang apabila diartikan secara harafiah adalah “sedotan terakhir”, beda jauh dengan arti sebenarnya yang mengindikasikan “serangkaian hal tidak menyenangkan yang kerap terjadi, hingga pada titik terakhir membuat seseorang akhirnya kehilangan kesabarannya”. Idiom memang biasanya tidak bisa dijelaskan dengan singkat, serta seringkali digunakan dalam sebuah kondisi unik yang spesifik.
Sedangkan terjemahan bebasadalah suatu terjemahan dengan berbagai jenis terjemahan.
20. Jelaskan secara lengkap tentang materi translation evaluation: accurate, clear and natural translation!
Jawaban:
Acurate = Akurat
Penjelasan:
semoga bermanfat
Jawaban:
acurate=akurat
clear=jelas
naturan
Penjelasan:
maaf kalo salah

0 komentar:
Posting Komentar